Mycoplasma phocicerebrale

(corr. Giebel et al., 1991)

Etymology

Gr. n. mukes – fungus, Gr. neut. n. plasma – anything formed, N.L. neut. n. Mycoplasma – fungus form; L. n. phoca – a seal, L. n. cerebrum – the brain, L. neut. suff. -ale – pertaining to, N.L. neut. adj. cerebrale – pertaining to the brain, N.L. neut. adj. phocicerebrale – of the brain of a seal (corrected by Heldtander Königsson et al., 2001)

Taxonomy

MycoplasmatalesMycoplasmataceaeMycoplasmaMycoplasma phocicerebrale (Hominis cluster), closely related to Mycoplasma enhydrae (16S rRNA gene sequence similarity – 99.04%) (Fig. 1)

Type strain

1049T (harbor seal – Phoca vitulina, Germany, 1988), (Fig. 2, 16S rRNA gene sequence)

Genomes

one completed (1049T – Germany) (NCBI Genome deposit per 11/05/2024)

Cell morphology

spherical – coccoid, often elongated, sporadically dumbbell-shaped

Colony morphology

fried egg morphology (Fig. 3)

Metabolism

hydrolysis of arginine; non-fermentative, non-urea-hydrolyzing

Host

pinnipeds including harbor seal, grey seal, and common seal, and Australian fur seal, once isolated from a harbor porpoise

Habitat

respiratory tract, also isolated from the heart, brain, wounds, and aborted fetuses

Disease(s)

considered to be a secondary pathogen potentially causing aggravation of respiratory disease and/or septicemia in association with other diseases (e.g. viral infection) or environmental factors, has also been associated with wound infection and abortion in pinnipeds and with seal finger resulting from seal bites in humans   

Pathogenicity

factors largely unknown, adhesion and cytotoxicity to epithelial cells have been demonstrated, carries protein M which binds the light chain region of host IgG to block antigen-specific binding

Epidemiology

has been isolated from pinnipeds in Germany, Australia, United Kingdom, USA, and Canada

Diagnosis

cultivation and species identification by MALDI-ToF MS, serology or genetically

Fig. 1. Maximum likelihood tree showing the phylogenetic position of Mycoplasma phocicerebrale 1049T within the Hominis cluster of Mycoplasmataceae based on 16S rRNA gene sequences. The sequence of Mycoplasma synoviae WVU 1853T was used as out-group (Synoviae cluster). Numbers at nodes represent bootstrap confidence values (1000 replications). Only values > 80% are shown. Bar, number of substitutions per nucleotide position. Credits: Joachim Spergser (Vetmeduni Vienna)

>Mycoplasma phocicerebrale 1049T
CTGGCTGTGTGCCTAATACATGCATGTCGAGCGAGGTTTCTTTTGAAGCCTAGCGGCGAATGGGTGAGTAACACGTGCTTAATCTACCCTTTAGATTGGAATACCCAATGGAAACATTGGCTAATGCCGGATACGCATGGAACCGCATGGTTCCGTTGTGAAAGGAGCTTTAAAGCTCCGCTAAAGGATGAGGGTGCGGAACATTAGTTAGTTGGTAGGGTAATGGCTTACCAAGACTATGATGTTTAGCCGGGTCGAGAGACTGAACGGCCACATTGGGACTGAGATACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATATTCCACAATGAGCGAAAGCTTGATGGAGCGACACAGCGTGCACGATGAAGGTCTTCGGATTGTAAAGTGCTGTTATAGGGAAAGAACACTTGGTTGAGGAAATGCTTCCAAGCTGACGGTACCCTGTCAGAAAGCGATGGCTAACTATGTGCCAGCAGCCGCGGTAATACATAGGTCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGTTCGTAGGCTGTTTATTAAGTCTGGAGTCAAATCCCGGGGCTCAACCCCGGCTCGCTTTGGATACTGGTAAACTAGAGTTAGATAGAGGTAAGCGGAATTCCATGTGAAGCGGTGAAATGCGTAGATATATGGAAGAACACCAAAGGCGAAGGCAGCTTACTGGGTCTATACTGACGCTGAGGGACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGATCATTAGTCGGTGGAGGATTCACTGACGCAGCTAACGCATTAAATGATCCGCCTGAGTAGTATGCTCGCAAGAGTGAAACTTAAAGGAATTGACGGGGACCCGCACAAGCGGTGGAGCATGTGGTTTAATTTGAAGATACGCGGAGAACCTTACCCACTCTTGACATCCTTCGCAAAGCTATAGAGATATAGTGGAGGTTAACGAAGTGACAGATGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGTTTGGTCAAGTCCTGCAACGAGCGCAACCCCTATCTTTAGTTACTAACGAGTCATGTCGAGGACTCTAGAGATACTGCCTGGGTAACTGGGAGGAAGGTGGGGATGACGTCAAATCATCATGCCTCTTACGAGTGGGGCAACACACGTGCTACAATGGTCGGTACAAAGAGAAGCAATATGGCGACATGGAGCAAATCTCAAAAAGCCGATCTCAGTTCGGATTGGAGTCTGCAATTCGACTCCATGAAGTCGGAATCGCTAGTAATCGCAGATCAGCTACGCTGCGGTGAATACGTTCTCGGGTCTTGTACACACCGCCCGTCACACCATGGGAGCTGGTAATACCCAAAGTCGGTTTGCTAACCTCGGAGGCGACCGCCTAAGGTAGGACTGGTGACTGGGGTGAAGTCGTAACAAGGT
Fig. 2. 16S rRNA gene sequence of Mycoplasma phocicerebrale 1049(Accession number: NR_025133)

Fig. 3. Colonies of Mycoplasma phocicerebrale 1049T on modified Hayflick’s agar after 4 days of incubation exhibiting fried egg morphology. Note, colour change of solid medium from ochre to reddish based on release of ammonia resulting from hydrolysis of arginine creating an alkaline pH. Bar, 1 mm. Credits: Joachim Spergser (Vetmeduni Vienna)

Species assigned by: Giebel, J., Meier, J., Binder, A., Flossdorf, J., Poveda, J.B., Schmidt, R., Kirchhoff, H. 1991. Mycoplasma phocarhinis sp. nov. and Mycoplasma phocacerebrale sp. nov., two new species from harbor seals (Phoca vitulina L.). Int. J. Syst. Bacteriol. 41: 39-44.

Scroll to Top