Mycoplasma mycoides ssp. mycoides

(Borrel et al., 1910; Freundt, 1955)

Etymology

Gr. n. mukes – fungus, Gr. neut. n. plasma – anything formed, N.L. neut. n. Mycoplasma – fungus form; G. n. mukes – fungus, L. suff. -oides – similar, N.L. neut. adj. mycoides – fungus-like

Taxonomy

MycoplasmatalesMycoplasmataceaeMycoplasmaMycoplasma mycoides ssp. mycoides (Mycoides cluster), closely related to Mycoplasma mycoides ssp. capri (16S rRNA gene sequence similarity – 99.59%) (Fig. 1); Mycoplasma mycoides ssp. mycoides is the type species of genus Mycoplasma; Note, former Mycoplasma mycoides ssp. mycoides Large Colony (LC) has been reclassified as serotype of Mycoplasma mycoides ssp. capri

Type strain

PG1T (cattle, Africa, ≤1931), (Fig. 2, 16S rRNA gene sequence)

Genomes

9 completed (PG1T – Africa; Gladysdale – Australia; izsam_mmm5713 – Italy; Ben1 and passages Ben50, Ben181, Ben326, Ben468 – China; T1/44 – Tanzania); 9 draft genomes (NCBI Genome deposit per 11/05/2024)

Cell morphology

spherical – coccoid

Colony morphology

fried egg morphology (Fig. 3)

Metabolism

fermentation of glucose; assimilation of glycerol (several strains); non-arginine-hydrolyzing, non-urea-hydrolyzing

Host

cattle and allied species (buffalo, bison, yak), occasionally isolated from sheep and goats

Habitat

respiratory tract

Disease(s)

Contagious Bovine Pleuropneumonia (CBPP), pneumonia (marbled lung) with pleurisy, rarely arthritis in calves

Pathogenicity

known factors are capsular polysaccharides contributing to adhesion and enhancing resistance to phagocytosis, Ig protease (MIB-MIP system), variable surface lipoproteins (vmm) involved in adhesion and immune evasion, production of hydrogen peroxide as a by-product of glycerol assimilation, biofilm formation

Epidemiology

endemic in western, central and eastern Africa, sporadic outbreaks in the Middle East; principal transmission mode is by aerosol, possibly wind-borne and indirect transmission  

Diagnosis

cultivation and species identification by MALDI-ToF MS, serology or genetically; PCR; detection of antibodies using immunoassays such as ELISA and Western blotting  

Fig. 1. Maximum likelihood tree showing the phylogenetic position of Mycoplasma mycoides ssp. mycoides PG1T within the Mycoides cluster of Mycoplasmataceae based on 16S rRNA gene sequences. The sequence of Mycoplasma synoviae WVU 1853T was used as out-group (Synoviae cluster). Numbers at nodes represent bootstrap confidence values (1000 replications). Only values > 80% are shown. Bar, number of substitutions per nucleotide position. Credits: Joachim Spergser (Vetmeduni Vienna)

>Mycoplasma mycoides ssp. mycoides PG1T
CTGGCGGCATGCCTAATACATGCAAGTCGAACGGAGGTGCTTGCACCTCAGTGGCGAACGGGTGAGTAACACGTATCTAACCTACCTCATAGCGGGGGATAACTTTTGGAAACGAAAGATAATACCGCATGTAGATCTTATTATCGCATGAGAAAAGATCAAAAGAACCGTTTGGTTCACTATGAGATGGGGATGCGGCGTATTAGCTAGTAGGTGAGATAATAGCCCACCTAGGCGATGATACGTAGCCGAACTGAGAGGTTGATCGGCCACATTGGGACTGAGATACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATTTTTCACAATGGACGAAAGTCTGATGAAGCAATGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAATCTCTGTTGTAAGGGAAGAAAAAATAAAGTAGGAAATGACTTTATCTTGACAGTACCTTACCAGAAAGCCACGGCTAACTATGTGCCAGCAGCCGCGGTAATACATAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTATAGGGTGCGTAGGCGGTTTTGCAAGTTTGAGGTTAAAGTCCGGAGCTCAACTCCGGTTCGCCTTGAAAACTGTATTACTAGAATGCAAGAGAGGTAAGCGGAATTCCATGTGTAGCGGTGAAATGCGTAGATATATGGAAGAACACCTGTGGCGAAAGCGGCTTACTGGCTTGTTATTGACGCTGAGGCACGAAAGCGTGGGGAGCAAATAGGATTAGATACCCTAGTAGTCCACGCCGTAAACGATGAGTACTAAGTGTTGGGGAAACTCAGCGCTGCAGCTAACGCATTAAGTACTCCGCCTGAGTAGTATGCTCGCAAGAGTGAAACTCAAAGGAATTGACGGGGACCCGCACAAGTGGTGGAGCATGTGGTTTAATTCGAAGCAACACGAAGAACCTTACCAGGGCTTGACATCCAGTGCAAAGCTATAGAGATATAGTAGAGGTTAACATTGAGACAGGTGGTGCATGGTTGTCGTCAGTTCGTGCCGTAAGGTGTTGGGTTAAGTCCCGCAACGAACGCAACCCTTGTCGCTAGTTACTAACATTAAGTTGAGAACTCTAACGAGACTGCTAGTGTAAGCTAGAGGAAGGTGGGGATGACGTCAAATCATCATGCCCCTTATGTCCTGGGCTACACACGTGCTACAATGGCTGGTACAAAGAGTTGCAATCCTGTGAAGGGGAGCTAATCTCAAAAAAACCAGTCTCAGTTCGGATTGAAGTCTGCAACTCGACTTCATGAAGCCGGAATCACTAGTAATCGCGAATCAGCTATGTCGCGGTGAATACGTTCTCGGGTCTTGTACACACCGCCCGTCACACCATGAGAGTTGGTAATACCAGAAGTAGGTAGCTTAACCATTTGGAGAGCGCTTCCCAAGGTAGGACTAGCGATTGGGGTGAAGTCGTAACAAGGT
Fig. 2. 16S rRNA gene sequence of Mycoplasma mycoides ssp. mycoides PG1T (Accession number: NR_074703)

Fig. 3. Colonies of Mycoplasma mycoides ssp. mycoides PG1T on modified Hayflick’s agar after 4 days of incubation exhibiting characteristic fried egg morphology. Bar, 1 mm. Credits: Joachim Spergser (Vetmeduni Vienna)

Species assigned by: Borrel, A., Dujardin-Beaumetz, E., Jeantet, R., Jouan, C. 1910. Le microbe de la péripneumonie. Ann. Inst. Pasteur 24: 168-179; Freundt, E.A. 1955. The classification of the pleuropneumonia group of organisms (Borrelomycetales). International Bulletin of Bacteriological Nomenclature and Taxonomy 5: 67-78.

Scroll to Top