Mycoplasma mycoides ssp. capri

(Edward, 1953; Freundt, 1955)

Etymology

Gr. n. mukes – fungus, Gr. neut. n. plasma – anything formed, N.L. neut. n. Mycoplasma – fungus form; G. n. mukes – fungus, L. suff. -oides – similar, N.L. neut. adj. mycoides – fungus-like; L. n. caper – a male goat, L. gen. n. capri – of the male goat

Taxonomy

MycoplasmatalesMycoplasmataceaeMycoplasmaMycoplasma mycoides ssp. capri (Mycoides cluster), closely related to Mycoplasma mycoides ssp. mycoides, Mycoplasma leachii, and Mycoplasma capricolum (16S rRNA gene sequence similarities – 99.59, 99.66, and 99.72%, respectively) (Fig. 1); Note, former Mycoplasma mycoides ssp. mycoides Large Colony (LC) has been reclassified as serotype of Mycoplasma mycoides ssp. capri

Type strain

PG3T (goat, Turkey, 1950), (Fig. 2, 16S rRNA gene sequence)

Genomes

40 completed (PG3T – Turkey; GM12 parent strain and 22 synthetics – USA; 95010, 7730 – both France; Ker.TCR.LT – India; Wi8079, G1313.94, G1283.94 – all Germany; My-1, My-5, My-325, My-18 – all Croatia; 83/93, 80/93, 171/93, 152/93 – all Spain; IVB-X – origin undefined; HN-A – China); 3 draft genomes (NCBI Genome deposit per 11/05/2024)

Cell morphology

spherical – coccoid

Colony morphology

fried egg morphology (Fig. 3)

Metabolism

fermentation of glucose; assimilation of glycerol; non-arginine-hydrolyzing, non-urea-hydrolyzing

Host

mainly goats, occasionally sheep and cattle

Habitat

respiratory tract, udder

Disease(s)

second main cause of Contagious Agalactia (CA) presenting mastitis with complete loss of milk production; septicemia with arthritis and pneumonia in kids; pleuropneumonia, mastitis, arthritis, kerato-conjunctivitis (MAKePS syndrome), and occasionally abortion in adult goats 

Pathogenicity

known factors are capsular polysaccharides contributing to adhesion and enhancing resistance to phagocytosis, Ig protease (MIB-MIP system), production of hydrogen peroxide as a by-product of glycerol assimilation, biofilm formation

Epidemiology

widest geographic distribution of ruminant mycoplasmas occurring in all continents; transmission by milk (at suckling, by milkers’ hands, milking machine, bedding) or via aerosol; commonly introduced into herds by latently infected carrier animals

Diagnosis

cultivation and species identification by MALDI-ToF MS, serology or genetically; PCR; detection of antibodies using immunoassays such as ELISA and Western blotting 

Fig. 1. Maximum likelihood tree showing the phylogenetic position of Mycoplasma mycoides ssp. capri PG3T within the Mycoides cluster of Mycoplasmataceae based on 16S rRNA gene sequences. The sequence of Mycoplasma synoviae WVU 1853T was used as out-group (Synoviae cluster). Numbers at nodes represent bootstrap confidence values (1000 replications). Only values > 80% are shown. Bar, number of substitutions per nucleotide position. Credits: Joachim Spergser (Vetmeduni Vienna)

>Mycoplasma mycoides ssp. capri PG3T
CTGGCGGCATGCCTAATACATGCAAGTCGAACGGAGGTGCTTGCACCTCAGTGGCGAACGGGTGAGTAACACGTATCTAACCTACCTCATAGCGGGGGATAACTTTTGGAAACGAAAGATAATACCGCATGTAGATCTTATTATCGCATGAGAAAAGATCAAAAGAACCGTTTGGTTCACTATGAGATGGGGATGCGGCGTATTAGCTAGTAGGTGAGATAATAGCCCACCTAGGCGATGATACGTAGCCGAACTGAGAGGTTGATCGGCCACATTGGGACTGAGATACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATTTTTCACAATGGACGAAAGTCTGATGAAGCAATGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTGTAAGGGAAGAAAAAATAAAGTAGGAAATGACTTTATCTTGACAGTACCTTACCAGAAAGCCACGGCTAACTATGTGCCAGCAGCCGCGGTAATACATAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTATAGGGTGCGTAGGCGGTTTTGCAAGTTTGAGGTTAAAGTCCGGAGCTCAACTCCGGTTCGCCTTGAAAACTGTATTACTAGAATGCAAGAGAGGTAAGCGGAATTCCATGTGTAGCGGTGAAATGCGTAGATATATGGAAGAACACCTGTGGCGAAAGCGGCTTACTGGCTTGTTATTGACGCTGAGGCACGAAAGCGTGGGGAGCAAATAGGATTAGATACCCTAGTAGTCCACGCCGTAAACGATGAGTACTAAGTGTTGGGGTAACTCAGCGCTGCAGCTAACGCATTAAGTACTCCGCCTGAGTAGTATGCTCGCAAGAGTGAAACTCAAAGGAATTGACGGGGACCCGCACAAGTGGTGGAGCATGTGGTTTAATTCGAAGCAACACGAAGAACCTTACCAGGGCTTGACATCCAGTGCAAAGCTATAGAGATATAGTAGAGGTTAACATTGAGACAGGTGGTGCATGGTTGTCGTCAGTTCGTGCCGTGAGGTGTTGGGTTAAGTCCCGCAACGAACGCAACCCTTGTCGTTAGTTACTAACATTAAGTTGAGAACTCTAACGAGACTGCTAGTGTAAGCTAGAGGAAGGTGGGGATGACGTCAAATCATCATGCCCCTTATGTCCTGGGCTACACACGTGCTACAATGGCTGGTACAAAGAGTTGCAATCCTGTGAAGGGGAGCTAATCTCAAAAAACCAGTCTCAGTTCGGATTGAAGTCTGCAACTCGACTTCATGAAGCCGGAATCACTAGTAATCGCGAATCAGCTATGTCGCGGTGAATACGTTCTCGGGTCTTGTACACACCGCCCGTCACACCATGAGAGTTGGTAATACCAGAAGTAGGTAGCTTAACCGTTTGGAGAGCGCTTCCCAAGGTAGGACTAGCGATTGGGGTGAAGTCGTAACAAGGT
Fig. 2. 16S rRNA gene sequence of Mycoplasma mycoides ssp. capri PG3T (Accession number: NR_118794)

Fig. 3. Large colonies with fried egg morphology of Mycoplasma mycoides ssp. capri PG3T on modified Hayflick’s agar after 3 days of incubation. Bar, 1 mm. Credits: Joachim Spergser (Vetmeduni Vienna)

Species assigned by: Edward, D.G. 1953. Organisms of the pleuropneumonia group causing disease in goats. Vet. Rec. 65: 873-874; Freundt, E.A. 1955. The classification of the pleuropneumonia group of organisms (Borrelomycetales). International Bulletin of Bacteriological Nomenclature and Taxonomy 5: 67-78.

Scroll to Top